miRBase entry: hsa-mir-186

Stem-loop hsa-mir-186


Accession
MI0000483
Symbol
HGNC: MIR186
Description
Homo sapiens hsa-mir-186 precursor miRNA
Gene family
MIPF0000109; mir-186

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR186 is a microRNA that has been identified as down-regulated in human prostate cancer (PCa) specimens, particularly in metastatic patients [PMC8431208]. Recent research has suggested that MIR186 acts as a metastasis suppressor in PCa [PMC8431208]. Furthermore, MIR186 has been found to play a tumor suppressive role in PCa by inhibiting tumorigenesis and metastasis, with its expression level being inversely correlated with clinical grade and pathological grading [PMC5078081]. Additionally, low expression of MIR186 has been associated with poor patient survival [PMC5078081]. Correlation analyses have revealed a positive correlation between miR25 and IL-12, while no significant correlations were found between miR21 and IL-21 or MIR186 and IL-12 [PMC9013931]. The role of the long non-coding RNA (lncRNA) PVT1 in regulating the expression of MIR186 has been demonstrated using lncRNA PVT1 silenced cholangiocarcinoma (CCA) cell lines [PMC8286192]. Overall, these findings highlight the importance of MIR186 as a potential therapeutic target for PCa due to its involvement in metastasis suppression and tumor suppression.

Literature search
92 open access papers mention hsa-mir-186
(771 sentences)

Sequence

861928 reads, 4834 reads per million, 157 experiments
ugcuuguaacuuucCAAAGAAUUCUCCUUUUGGGCUuucugguuuuauuuuaaGCCCAAAGGUGAAUUUUUUGGGaaguuugagcu
.(((((.(((((((((((((((((.(((((.((((((..............))))))))))).)))))))))))))))))))))).

Structure
u     u                 U     U      ucuggu 
 gcuug aacuuucCAAAGAAUUC CCUUU GGGCUu      u
 ||||| ||||||||||||||||| ||||| ||||||       
 cgagu uugaaGGGUUUUUUAAG GGAAA CCCGaa      u
u     -                 U     -      uuuuau 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr1: 71067631-71067716 [-]

Disease association
hsa-mir-186 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-186-5p

Accession MIMAT0000456
Description Homo sapiens hsa-miR-186-5p mature miRNA
Sequence 15 - CAAAGAAUUCUCCUUUUGGGCU - 36
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-186-3p

Accession MIMAT0004612
Description Homo sapiens hsa-miR-186-3p mature miRNA
Sequence 54 - GCCCAAAGGUGAAUUUUUUGGG - 75
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179