miRBase entry: hsa-mir-186

Stem-loop hsa-mir-186


Accession
MI0000483
Symbol
HGNC: MIR186
Description
Homo sapiens hsa-mir-186 precursor miRNA mir-186
Gene
family?
RF00697; mir-186

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR186 is identified as a microRNA that exhibits a tumor suppressive role in prostate cancer (PCa), with its down-regulation observed in human PCa specimens, particularly in those from metastatic patients, suggesting its function as a metastasis suppressor [PMC8431208]. The expression level of MIR186 is inversely associated with clinical grade and pathological grading in PCa, and lower levels of MIR186 are linked to reduced survival rates among patients [PMC5078081]. While MIR186 has been implicated in the regulation of Twist1 expression and associated with cisplatin resistance in ovarian cancer, its tumor-suppressive effects in PCa are characterized by the inhibition of tumorigenesis and metastasis [PMC5078081]. Additionally, the study found no significant correlation between MIR186 and IL-12 levels, unlike the positive correlation observed between miR25 and IL-12 [PMC9013931]. The regulation of MIR186 expression by the long non-coding RNA (lncRNA) PVT1 has been demonstrated through experiments involving lncRNA PVT1 silenced cholangiocarcinoma (CCA) cell lines, further elucidating the molecular mechanisms controlling MIR186 levels [PMC8286192].

Literature search
92 open access papers mention hsa-mir-186
(771 sentences)

Sequence

861928 reads, 2442 reads per million, 157 experiments
ugcuuguaacuuucCAAAGAAUUCUCCUUUUGGGCUuucugguuuuauuuuaaGCCCAAAGGUGAAUUUUUUGGGaaguuugagcu
.(((((.(((((((((((((((((.(((((.((((((..............))))))))))).)))))))))))))))))))))).

Structure
u     u                 U     U      ucuggu 
 gcuug aacuuucCAAAGAAUUC CCUUU GGGCUu      u
 ||||| ||||||||||||||||| ||||| ||||||       
 cgagu uugaaGGGUUUUUUAAG GGAAA CCCGaa      u
u     -                 U     -      uuuuau 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr1: 71067631-71067716 [-]

Disease association
hsa-mir-186 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-186-5p

Accession MIMAT0000456
Description Homo sapiens hsa-miR-186-5p mature miRNA
Sequence 15 - CAAAGAAUUCUCCUUUUGGGCU - 36
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-186-3p

Accession MIMAT0004612
Description Homo sapiens hsa-miR-186-3p mature miRNA
Sequence 54 - GCCCAAAGGUGAAUUUUUUGGG - 75
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179