miRBase entry: hsa-mir-193a

Stem-loop hsa-mir-193a


Accession
MI0000487
Symbol
HGNC: MIR193A
Description
Homo sapiens hsa-mir-193a precursor miRNA mir-193
Gene
family?
RF01895; mir-193

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR193A, a microRNA, has been observed to be overexpressed in podocytes in primary FSGS biopsies, while genetic FSGS and minimal change disease show low MIR193A levels, similar to normal kidneys [PMC9953542]. Contrary to the suggestion of overexpression's regulatory interaction with VDR/RXR expression, the context actually suggests a causal relationship between VDR/RXR expression and downregulation of MIR193A [PMC7226544]. In vitro studies have demonstrated that MIR193A can inhibit micro-vessel formation, indicating its role in cellular processes [PMC9562882]. The expression levels of MIR193A by precursor progenitor cells are crucial for determining their differentiation into either parietal epithelial cells (PECs) or podocytes through the modulation of WT1 [PMC9953542]. The activity of MIR193A is influenced by its 3’ UTR position relative to the stop codon and the location of its seed region [PMC7226544]. In hepatocellular carcinoma (HCC), down-modulation of MIR193A has been associated with disease diagnosis and prognosis, and unlike miR-23b, it is not regulated by DNA methylation [PMC5351682]. Transcription factors such as YY1, WT1, and Sox2 have potential regulatory roles on MIR193A expression through binding to its promoter region [PMC7226544]. Advanced mouse colon cancer cells have been found to secrete exosomes containing MVP along with tumor-suppressive MIR193A [PMC7916137], and MIR193A is suggested to bind to the APOL1 3’ UTR region mRNA, affecting cytoskeletal organization in podocytes [PMC8391400; PMC7226544]..

Literature search
389 open access papers mention hsa-mir-193a
(1915 sentences)

Sequence

168503 reads, 442.0 reads per million, 189 experiments
cgaggaugggagcugagggcUGGGUCUUUGCGGGCGAGAUGAgggugucggaucAACUGGCCUACAAAGUCCCAGUucucggcccccg
.......(((.(((((((((((((.(((((.((((.((.(((..........))).)).)))).))))).))))))))))))).))).

Structure
cgaggau   a             U     C    G  A   gggu 
       ggg gcugagggcUGGG CUUUG GGGC AG UGA    g
       ||| ||||||||||||| ||||| |||| || |||     
       ccc cggcucuUGACCC GAAAC UCCG UC Acu    u
------g   c             U     A    G  A   aggc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr17: 31559996-31560083 [+]

Disease association
hsa-mir-193a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-193a-5p

Accession MIMAT0004614
Description Homo sapiens hsa-miR-193a-5p mature miRNA
Sequence 21 - UGGGUCUUUGCGGGCGAGAUGA - 42
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-193a-3p

Accession MIMAT0000459
Description Homo sapiens hsa-miR-193a-3p mature miRNA
Sequence 55 - AACUGGCCUACAAAGUCCCAGU - 76
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179