miRBase entry: mmu-mir-30c-2

Stem-loop mmu-mir-30c-2


Accession
MI0000548
Symbol
MGI: Mir30c-2
Description
Mus musculus mmu-mir-30c-2 precursor miRNA
Gene family
MIPF0000005; mir-30

Literature search
212 open access papers mention mmu-mir-30c-2
(1301 sentences)

Sequence

512704 reads, 1771 reads per million, 107 experiments
gagugacagauauUGUAAACAUCCUACACUCUCAGCugugaaaaguaagaaagCUGGGAGAAGGCUGUUUACUCUcucugccuu
(((.(.((((....(((((((.(((...(((((((((..............))))))))).))).)))))))....))))))))

Structure
   u a    uauU       U   ACA         gugaaa 
gag g caga    GUAAACA CCU   CUCUCAGCu      a
||| | ||||    ||||||| |||   |||||||||       
uuc c gucu    CAUUUGU GGA   GAGGGUCga      g
   - -    cUCU       C   --A         aagaau 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-30c was cloned and mapped to chromosome 4 in reference [1] (MIR:MI0000547). A search of more recent mouse genome assemblies suggests the presence of a second locus encoding miR-30c on chromosome 1, represented by this entry.

Genome context
chr1: 23291701-23291784 [+]

Database links

Mature mmu-miR-30c-5p

Accession MIMAT0000514
Description Mus musculus mmu-miR-30c-5p mature miRNA
Sequence 14 - UGUAAACAUCCUACACUCUCAGC - 36
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-30c-2-3p

Accession MIMAT0005438
Description Mus musculus mmu-miR-30c-2-3p mature miRNA
Sequence 54 - CUGGGAGAAGGCUGUUUACUCU - 75
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009