miRBase entry: mmu-let-7c-1

Stem-loop mmu-let-7c-1


Accession
MI0000559
Symbol
MGI: Mirlet7c-1
Description
Mus musculus mmu-let-7c-1 precursor miRNA
Gene family
MIPF0000002; let-7

Literature search
430 open access papers mention mmu-let-7c-1
(2415 sentences)

Sequence

26886123 reads, 47495 reads per million, 107 experiments
ugugugcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaaCUGUACAACCUUCUAGCUUUCCuuggagcacacu
.((((((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..)))))))))))).

Structure
u      a      uU   G   U             ua  g ua  c 
 gugugc uccggg  GAG UAG AGGUUGUAUGGUU  ga u  ca  
 |||||| ||||||  ||| ||| |||||||||||||  || |  || c
 cacacg agguuC  UUC AUC UCCAACAUGUCaa  uu a  gu  
u      -      CU   G   U             --  g gg  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr16: 77599657-77599750 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-let-7c-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-let-7c-5p

Accession MIMAT0000523
Description Mus musculus mmu-let-7c-5p mature miRNA
Sequence 16 - UGAGGUAGUAGGUUGUAUGGUU - 37
Evidence experimental
cloned [1,3-5], Northern [2], Illumina [6-7]
Database links
Predicted targets

Mature mmu-let-7c-1-3p

Accession MIMAT0004622
Description Mus musculus mmu-let-7c-1-3p mature miRNA
Sequence 61 - CUGUACAACCUUCUAGCUUUCC - 82
Evidence experimental
cloned [5], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009