miRBase entry: mmu-mir-16-2

Stem-loop mmu-mir-16-2


Accession
MI0000566
Symbol
MGI: Mir16-2
Description
Mus musculus mmu-mir-16-2 precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Literature search
268 open access papers mention mmu-mir-16-2
(1756 sentences)

Sequence

1762971 reads, 5952 reads per million, 107 experiments
caugcuuguuccacucUAGCAGCACGUAAAUAUUGGCGuagugaaauaaauauuaaacACCAAUAUUAUUGUGCUGCUUUagugugacagggaua
.((.((((((.((((..(((((((((..((((((((.((.................)).))))))))..)))))))))..)))).)))))).)).

Structure
c  g      c    cU         UA        C  agugaaa 
 au cuuguu cacu  AGCAGCACG  AAUAUUGG Gu       u
 || |||||| ||||  |||||||||  |||||||| ||       a
 ua ggacag guga  UCGUCGUGU  UUAUAACC ca       a
a  g      u    UU         UA        A  aauuaua 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr3: 69009902-69009996 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-16-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-16-5p

Accession MIMAT0000527
Description Mus musculus mmu-miR-16-5p mature miRNA
Sequence 17 - UAGCAGCACGUAAAUAUUGGCG - 38
Evidence experimental
cloned [1-2,4-5], Northern [2], Illumina [6,8]
Database links
Predicted targets

Mature mmu-miR-16-2-3p

Accession MIMAT0017018
Description Mus musculus mmu-miR-16-2-3p mature miRNA
Sequence 59 - ACCAAUAUUAUUGUGCUGCUUU - 80
Evidence experimental
454 [7], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  8. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275