miRBase entry: mmu-mir-18a

Stem-loop mmu-mir-18a


Accession
MI0000567
Symbol
MGI: Mir18
Description
Mus musculus mmu-mir-18a precursor miRNA
Gene family
MIPF0000001; mir-17

Literature search
122 open access papers mention mmu-mir-18a
(542 sentences)

Sequence

91120 reads, 1228 reads per million, 105 experiments
ugcgugcuuuuuguucUAAGGUGCAUCUAGUGCAGAUAGugaaguagacuagcaucuACUGCCCUAAGUGCUCCUUCUGgcauaagaaguuauguc
.(((((((((((((.((((((.((((.(((.((((.(((((...........)).))))))).))).)))).)))..))).)))))))).))))).

Structure
u     -        u   --   U    C   U    A   -  aagu 
 gcgug cuuuuugu cUA  AGG GCAU UAG GCAG UAG ug    a
 ||||| |||||||| |||  ||| |||| ||| |||| ||| ||    g
 uguau gaagaaua gGU  UCC CGUG AUC CGUC Auc ac    a
c     u        c   CU   U    A   C    -   u  gauc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr14: 115043851-115043946 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-18a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-18a-5p

Accession MIMAT0000528
Description Mus musculus mmu-miR-18a-5p mature miRNA
Sequence 17 - UAAGGUGCAUCUAGUGCAGAUAG - 39
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-18a-3p

Accession MIMAT0004626
Description Mus musculus mmu-miR-18a-3p mature miRNA
Sequence 58 - ACUGCCCUAAGUGCUCCUUCUG - 79
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009