miRBase entry: mmu-mir-26b

Stem-loop mmu-mir-26b


Accession
MI0000575
Symbol
MGI: Mir26b
Description
Mus musculus mmu-mir-26b precursor miRNA
Gene family
MIPF0000043; mir-26

Literature search
102 open access papers mention mmu-mir-26b
(549 sentences)

Sequence

762996 reads, 2699 reads per million, 107 experiments
ugcccgggacccagUUCAAGUAAUUCAGGAUAGGUuguggugcugaccagCCUGUUCUCCAUUACUUGGCUCgggggccggugcc
.((((((..((((((.((((((((..(((((((((..((((....)))))))))))))..))))))))))).)))..)))).)).

Structure
u  -    ga   -   U        UC         ug    g 
 gc ccgg  ccc agU CAAGUAAU  AGGAUAGGU  uggu c
 || ||||  ||| ||| ||||||||  |||||||||  ||||  
 cg ggcc  ggg UCG GUUCAUUA  UCUUGUCCg  acca u
c  u    gg   C   -        CC         --    g 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
chr1: 74394310-74394394 [+]

Database links

Mature mmu-miR-26b-5p

Accession MIMAT0000534
Description Mus musculus mmu-miR-26b-5p mature miRNA
Sequence 15 - UUCAAGUAAUUCAGGAUAGGU - 35
Evidence experimental
cloned [1-2,4-6], Northern [2], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-26b-3p

Accession MIMAT0004630
Description Mus musculus mmu-miR-26b-3p mature miRNA
Sequence 51 - CCUGUUCUCCAUUACUUGGCUC - 72
Evidence experimental
cloned [6], Illumina [7-8]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  6. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  7. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  8. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009