![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-322-1 |
||||||||||||||
Accession | MI0000589 (change log) | |||||||||||||
Previous IDs | rno-mir-322 | |||||||||||||
Description | Rattus norvegicus miR-322-1 stem-loop | |||||||||||||
Gene family | MIPF0000164; mir-322 | |||||||||||||
Literature search |
![]()
14 open access papers mention rno-mir-322-1 | |||||||||||||
Stem-loop |
ccucgcuga - a ca aa g auu 5' cuc cgaaggg ug gcagc uucauguuuugga u g ||| ||||||| || ||||| ||||||||||||| | 3' ggg gcuuccc ac cgucg aaguacaaaacuu g c ------aaa u c aa cg g aac |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence rno-miR-322-5p |
|
Accession | MIMAT0001619 |
Previous IDs | rno-miR-424;rno-miR-322 |
Sequence |
23 - cagcagcaauucauguuuugga - 44 |
Deep sequencing | 1144242 reads, 493 experiments |
Evidence | experimental; cloned [2-3], SOLiD [4] |
Mature sequence rno-miR-322-3p |
|
Accession | MIMAT0000547 |
Previous IDs | rno-miR-322;rno-miR-322* |
Sequence |
61 - aaacaugaagcgcugcaaca - 80 |
Deep sequencing | 252618 reads, 498 experiments |
Evidence | experimental; cloned [1-2], SOLiD [4] |
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|