MIR1-1 is a type of miR1 in mammals that is mainly related to skeletal muscle development [PMC5424345]. In prostate cancer (PCa), miR-1 pretreatment was used to collect differentially expressed genes (DEGs), and the Gene Expression Omnibus (GEO) and ArrayExpress databases were searched with specific retrieval strategies [PMC6236292]. MIR1-1, along with other cardiac myomiRs, was found to be unperturbed in NKX2-5 knockout cardiomyocytes [PMC6828809]. The expression of MIR1-1, along with other myogenic miRNAs, was established during pluripotent stem cell differentiation into the cardiac lineage [PMC6828809]. MIR1-1 is a muscle-specific microRNA that is produced during the early stage of cardiogenesis [PMC7123062]. It has been implicated in the regulation of cardiac contraction and embryonic angiogenesis [PMC8624534]. SRF activates MIR1-1, along with miR133a, which regulates many mRNAs of MRTF-SRF target genes [PMC9185982]. MIR1-1 has been used as a target for mRNA co-delivery experiments in cardiomyocytes [PMC7832270]. It is embedded in the MIR1-1HG gene and promotes muscle differentiation and expression during myogenesis [PMC5137429]. In colorectal cancer (CRC), MIR1-1 and MIR133A2 had a copy number gain in approximately 7% of patients [PMC4967895]. The relative abundance of URA5 mRNA in samples with knockdown by miR1-1 was significantly lower compared to wild type samples [PMC3530498].
a GC --- a uggga ACAUACUUCUUUAUAU CCAUa ugg c ||||| |||||||||||||||| ||||| ||| c acucU UGUAUGAAGAAAUGUA GGUau auc u A -A cga g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000416 |
Description | Homo sapiens hsa-miR-1-3p mature miRNA |
Sequence | 46 - UGGAAUGUAAAGAAGUAUGUAU - 67 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0031892 |
Description | Homo sapiens hsa-miR-1-5p mature miRNA |
Sequence | 7 - ACAUACUUCUUUAUAUGCCCAU - 28 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|