miRBase entry: mmu-mir-212

Stem-loop mmu-mir-212


Accession
MI0000696
Symbol
MGI: Mir212
Description
Mus musculus mmu-mir-212 precursor miRNA
Gene family
MIPF0000065; mir-132

Literature search
76 open access papers mention mmu-mir-212
(633 sentences)

Sequence

23017 reads, 178 reads per million, 102 experiments
gggcagcgcgccggcACCUUGGCUCUAGACUGCUUACUgcccgggccgccuucagUAACAGUCUCCAGUCACGGCCAccgacgccuggccc
((.(((.(((.(((..((.(((((..((((((.((((((...((....))..))))))))))))..))))).))...))).)))))).)).

Structure
-  g   c   c   -cA  U     CU      C      ccc  g 
 gg cag gcg cgg   CC UGGCU  AGACUG UUACUg   gg c
 || ||| ||| |||   || |||||  |||||| ||||||   ||  
 cc guc cgc gcc   GG ACUGA  UCUGAC AAUgac   cc c
c  g   -   a   ACC  C     CC      -      -uu  g 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr11: 75173388-75173478 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-212
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-212-5p

Accession MIMAT0017053
Description Mus musculus mmu-miR-212-5p mature miRNA
Sequence 16 - ACCUUGGCUCUAGACUGCUUACU - 38
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-212-3p

Accession MIMAT0000659
Description Mus musculus mmu-miR-212-3p mature miRNA
Sequence 56 - UAACAGUCUCCAGUCACGGCCA - 77
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73