![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-223 |
|||||
Accession | MI0000703 (change log) | ||||
Symbol | MGI:Mir223 | ||||
Description | Mus musculus miR-223 stem-loop | ||||
Gene family | MIPF0000067; mir-223 | ||||
Literature search |
![]()
185 open access papers mention mmu-mir-223 | ||||
Stem-loop |
u ccaucu -gu cc u gaguug u 5' cugg gca gucacgcu g guauuugacaagcu gacacucug g |||| ||| |||||||| | |||||||||||||| ||||||||| u 3' gacu cgu cgguguga c cauaaacuguuuga cugugagau g - ---auc acu ac c ------ g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Mouse mir-223 is predicted [2] based on homology to a reported miR from human (MI0000300) [1]. Its expression was later verified by cloning [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-223-5p |
|
Accession | MIMAT0017056 |
Previous IDs | mmu-miR-223* |
Sequence |
26 - cguguauuugacaagcugaguug - 48 |
Deep sequencing | 13863 reads, 88 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-223-3p |
|
Accession | MIMAT0000665 |
Previous IDs | mmu-miR-223 |
Sequence |
68 - ugucaguuugucaaauacccca - 89 |
Deep sequencing | 574187 reads, 96 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|