miRBase entry: mmu-mir-125b-1

Stem-loop mmu-mir-125b-1


Accession
MI0000725
Symbol
MGI: Mir125b-1
Description
Mus musculus mmu-mir-125b-1 precursor miRNA
Gene family
MIPF0000033; mir-10

Literature search
258 open access papers mention mmu-mir-125b-1
(1476 sentences)

Sequence

1699627 reads, 11761 reads per million, 113 experiments
ugcgcuccccucagUCCCUGAGACCCUAACUUGUGAuguuuaccguuuaaauccACGGGUUAGGCUCUUGGGAGCUg
...........((((.(((((((.(((((((((((..(((((.....))))).))))))))))).))))))).))))

Structure
ugcgcuccccu    C       C           Au     c 
           cagU CCUGAGA CCUAACUUGUG  guuua c
           |||| ||||||| |||||||||||  ||||| g
           gUCG GGGUUCU GGAUUGGGCAc  uaaau u
-----------    A       C           -c     u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 41581926-41582002 [+]

Database links

Mature mmu-miR-125b-5p

Accession MIMAT0000136
Description Mus musculus mmu-miR-125b-5p mature miRNA
Sequence 15 - UCCCUGAGACCCUAACUUGUGA - 36
Evidence experimental
cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-125b-1-3p

Accession MIMAT0004669
Description Mus musculus mmu-miR-125b-1-3p mature miRNA
Sequence 55 - ACGGGUUAGGCUCUUGGGAGCU - 76
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73