miRBase entry: mmu-mir-7b

Stem-loop mmu-mir-7b


Accession
MI0000730
Symbol
MGI: Mir7b
Description
Mus musculus mmu-mir-7b precursor miRNA
Gene family
MIPF0000022; mir-7

Literature search
114 open access papers mention mmu-mir-7b
(1009 sentences)

Sequence

17340 reads, 315 reads per million, 55 experiments
aggagcggaguacgugagccagugcuaugUGGAAGACUUGUGAUUUUGUUGUUcugauaugauaugaCAACAAGUCACAGCCAGCCUCAuagcguggacuccuaucaccuu
..((..(((((.......(((.(((((((.((.....(((((((((.((((((.((......)).)))))))))))))))....)).)))))))))))))))..)).....

Structure
---ag  gc     acgugag   g       U  AAGAC         U      c  au 
     ga  ggagu       cca ugcuaug GG     UUGUGAUUU GUUGUU ug  a
     ||  |||||       ||| ||||||| ||     ||||||||| |||||| ||   
     cu  ccuca       ggu gcgauAC CC     GACACUGAA CAACag au  u
uucca  au     -------   -       U  -GACC         -      u  ag 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MIR:MI0000728) and mir-7-2 (MIR:MI0000729) in mouse, and mir-7-1 (MIR:MI0000263), mir-7-2 (MIR:MI0000264) and mir-7-3 (MIR:MI0000265) in human.

Genome context
chr17: 56242988-56243098 [+]

Database links

Mature mmu-miR-7b-5p

Accession MIMAT0000678
Description Mus musculus mmu-miR-7b-5p mature miRNA
Sequence 30 - UGGAAGACUUGUGAUUUUGUUGUU - 53
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-7b-3p

Accession MIMAT0017071
Description Mus musculus mmu-miR-7b-3p mature miRNA
Sequence 68 - CAACAAGUCACAGCCAGCCUCA - 89
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009