miRBase entry: hsa-mir-34c

Stem-loop hsa-mir-34c


Accession
MI0000743
Symbol
HGNC: MIR34C
Description
Homo sapiens hsa-mir-34c precursor miRNA
Gene family
MIPF0000039; mir-34

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR34C is a microRNA that regulates gene expression [PMC4067617]. In a study, it was found that the gene expression of Bcl-2 was highly expressed only in embryos at day 1 after treatment with the VFm34cI, which inhibits the function of MIR34C [PMC4067617]. This suggests that the VFm34cI was successfully delivered into zygotes and effectively inhibited MIR34C function [PMC4067617]. To further investigate the differences in MIR34C expression induced by Zika infection, a real-time PCR (Taqman assay) was conducted on three different clones [PMC6425033].

Literature search
448 open access papers mention hsa-mir-34c
(2624 sentences)

Sequence

171442 reads, 1301 reads per million, 102 experiments
agucuaguuacuAGGCAGUGUAGUUAGCUGAUUGCuaauaguaccAAUCACUAACCACACGGCCAGGuaaaaagauu
.((((..(((((.(((.((((.(((((.((((((.((....)).))))))))))).)))).))).)))))..)))).

Structure
a    ag     A   A    A     C      C  a 
 gucu  uuacu GGC GUGU GUUAG UGAUUG ua u
 ||||  ||||| ||| |||| ||||| |||||| ||  
 uaga  aauGG CCG CACA CAAUC ACUAAc au a
u    aa     A   G    C     -      c  g 


Annotation confidence High
Do you think this miRNA is real?
Comments
Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.

Genome context
chr11: 111513439-111513515 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-34c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-34c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-34c is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-34c is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-34c-5p

Accession MIMAT0000686
Description Homo sapiens hsa-miR-34c-5p mature miRNA
Sequence 13 - AGGCAGUGUAGUUAGCUGAUUGC - 35
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-34c-3p

Accession MIMAT0004677
Description Homo sapiens hsa-miR-34c-3p mature miRNA
Sequence 46 - AAUCACUAACCACACGGCCAGG - 67
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358