MIR99B is a microRNA located just downstream of a cluster of microRNAs on the human transcriptional unit AY358799 and is highly expressed in various biological contexts [PMC3783845], [PMC7912193]. It plays a role in the immune response by restricting bacterial growth when its expression is blocked [PMC3576108]. Despite its high expression levels, MIR99B, along with other frequently expressed miRNAs, targets fewer genes compared to less expressed miRNAs [PMC7912193]. It has been identified in extracellular vesicles (EVs) and is the second most expressed miRNA within them, suggesting its potential role in intercellular communication [PMC7912193]. MIR99B has been implicated in the regulation of insulin-like growth factor 1 receptor (IGF1R) and may contribute to a coordinated shutdown of signal transduction pathways that block NF-κB pathways [PMC4290566]. In various diseases, MIR99B expression levels differ; it is upregulated in cystic fibrosis airway epithelial cells and downregulated in endometrial cancer cells, indicating its complex role as both a potential tumor suppressor and as part of the body's response to certain diseases [PMC7493015], [PMC6994408]. Furthermore, MIR99B has been engineered into an adenovirus to enhance antitumoral activity against pancreatic cancer cells, highlighting its therapeutic potential [PMC9171400].
cC AC C --C g c ggcac ACCCGUAGA CGA CUUG G ggc u ||||| ||||||||| ||| |||| | ||| cuguG UGGGUGUCU GCU GAAC c ccg u CC GU C aca g c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000689 |
Description | Homo sapiens hsa-miR-99b-5p mature miRNA |
Sequence | 7 - CACCCGUAGAACCGACCUUGCG - 28 |
Evidence |
experimental
cloned [4-6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004678 |
Description | Homo sapiens hsa-miR-99b-3p mature miRNA |
Sequence | 45 - CAAGCUCGUGUCUGUGGGUCCG - 66 |
Evidence |
experimental
cloned [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|