Stem-loop sequence cel-mir-355

Accession

MI0000754 (change log)

Description

Caenorhabditis elegans miR-355 stem-loop

Gene family

MIPF0000236; mir-355

Literature search

2 open access papers mention cel-mir-355
(22 sentences)

Stem-loop

   -----aauaa      ---ga     a    u         -cu        ---ag  a 
5'           ugucaa     auuga uggu uguuuuagc   gagcuaug     uc u
             ||||||     ||||| |||| |||||||||   ||||||||     ||  
3'           gcaguu     uaacu accg acaaaaucg   uucgauac     ag c
   aguuuuugaa      aauuc     a    u         uuc        guaua  g 

Deep sequencing

4040 reads, 14.3 reads per million, 14 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The 5' end of the mature sequence was mapped by PCR, and the 3' end confirmed later [2].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrII: 11833536-11833645 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from cel-mir-355

• cel-mir-8188: chrII: 11840444-11840500 [-]
• cel-mir-355: chrII: 11833536-11833645 [-]

Database links

• RNAcentral:URS000005CC06_6239
• miRBase Tracker:MI0000754

Mature sequence cel-miR-355-5p

• Accession: MIMAT0000697
• Previous IDs: cel-miR-355
• Sequence: 23 - uuuguuuuagccugagcuaug - 43
• Deep sequencing: 4024 reads, 13 experiments
• Evidence: experimental; cloned [1-2], PCR [1], Illumina [3]
• Database links:
  • RNAcentral:URS0000280D2A_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-355
  • microrna.org:cel-miR-355-5p

Mature sequence cel-miR-355-3p

• Accession: MIMAT0031895
• Sequence: 61 - uagcuucuugcuaaaacaugcc - 82
• Deep sequencing: 7 reads, 6 experiments
• Evidence: not experimental

References

1. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).