Stem-loop sequence cel-mir-357

AccessionMI0000756 (change log)
DescriptionCaenorhabditis elegans miR-357 stem-loop
Gene family MIPF0000227; mir-357
Literature search

1 open access papers mention cel-mir-357
(4 sentences)

Stem-loop 
   a   --ug       cacca     uc   a     -   c    a     gaaca 
5'  cgc    uacuacu     gcgga  ccu caacg cug gcau ugcau     c
    |||    |||||||     |||||  ||| ||||| ||| |||| |||||     a
3'  gcg    augauga     cgcuu  gga guugc gac cgua augua     a
   c   uaaa       -caua     ga   c     u   -    a     aaagu
Get sequence
Deep sequencing
1520 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 8580542-8580651 [-]
antisense
F25G6.2 ; F25G6.2; intron 5
Clustered miRNAs
< 10kb from cel-mir-357
cel-mir-358chrV: 8580858-8580967 [-]
cel-mir-357chrV: 8580542-8580651 [-]
Database links

Mature sequence cel-miR-357-5p

Accession MIMAT0020343
Previous IDscel-miR-357*
Sequence

25 -  

cccuacaacgcugcgcauaugc

 - 46

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [5]

Mature sequence cel-miR-357-3p

Accession MIMAT0000699
Previous IDscel-miR-357
Sequence

66 -  

aaaugccagucguugcaggagu

 - 87

Get sequence
Deep sequencing1513 reads, 14 experiments
Evidence experimental; cloned [1-2], PCR [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).