Stem-loop sequence cel-mir-359

AccessionMI0000758 (change log)
DescriptionCaenorhabditis elegans miR-359 stem-loop
Gene family MIPF0000371; mir-359
Literature search

1 open access papers mention cel-mir-359
(1 sentences)

Stem-loop 
   --------aa  -    uu   a       -        u  c  a    u      ccu 
5'           ug cucc  gaa uuucaau cguuagag aa ac cagu acacga   c
             || ||||  ||| ||||||| |||||||| || || |||| ||||||   a
3'           ac gagg  cuu gaaguua gcagucuc uu ug guca ugugcu   u
   guugguuuua  a    -u   -       a        u  c  -    c      aac
Get sequence
Deep sequencing
789 reads, 7.69 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 3004291-3004400 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-359
cel-mir-359chrX: 3004291-3004400 [+]
cel-mir-785chrX: 3004668-3004761 [+]
cel-mir-249chrX: 3006440-3006536 [-]
Database links

Mature sequence cel-miR-359

Accession MIMAT0000701
Sequence

62 -  

ucacuggucuuucucugacgaa

 - 83

Get sequence
Deep sequencing772 reads, 13 experiments
Evidence experimental; cloned [1-2], PCR [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).