miRBase entry: mmu-mir-361

Stem-loop mmu-mir-361


Accession
MI0000761
Symbol
MGI: Mir361
Description
Mus musculus mmu-mir-361 precursor miRNA
Gene family
MIPF0000172; mir-361

Literature search
20 open access papers mention mmu-mir-361
(304 sentences)

Sequence

46111 reads, 332 reads per million, 106 experiments
gaagcUUAUCAGAAUCUCCAGGGGUACuuaguauuugaaaagUCCCCCAGGUGUGAUUCUGAUUUGUuuc
(((((..(((((((((.((.((((.((((..........)))).)))).))...)))))))))..)))))

Structure
     UU         --U  A    U    agua 
gaagc  AUCAGAAUC   CC GGGG ACuu    u
|||||  |||||||||   || |||| ||||     
cuuUG  UAGUCUUAG   GG CCCC Ugaa    u
     UU         UGU  A    C    aagu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 113074824-113074893 [-]

Database links

Mature mmu-miR-361-5p

Accession MIMAT0000704
Description Mus musculus mmu-miR-361-5p mature miRNA
Sequence 6 - UUAUCAGAAUCUCCAGGGGUAC - 27
Evidence experimental
cloned [1-2], Illumina [3,5]
Database links
Predicted targets

Mature mmu-miR-361-3p

Accession MIMAT0017075
Description Mus musculus mmu-miR-361-3p mature miRNA
Sequence 43 - UCCCCCAGGUGUGAUUCUGAUUUGU - 67
Evidence experimental
454 [4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275