miRBase entry: hsa-mir-363

Stem-loop hsa-mir-363


Accession
MI0000764
Symbol
HGNC: MIR363
Description
Homo sapiens hsa-mir-363 precursor miRNA
Gene family
MIPF0000138; mir-363

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR363, a type of microRNA, has been investigated in the context of prostate cancer (PCa) [PMC10067432]. Research utilizing RIP assays has demonstrated that MIR363, along with miR708 and circEZH2E2/E3, can be identified in immunoprecipitates obtained with anti-Ago2 [PMC10067432]. Additionally, the levels of MIR363 and miR708 were found to be significantly lower in PCa tissue samples and PCa cells (PC3 and DU145) compared to benign prostatic hyperplasia (BPH) [PMC10067432]. These findings suggest a potential involvement of MIR363 in the development or progression of PCa [PMC10067432].

Literature search
76 open access papers mention hsa-mir-363
(499 sentences)

Sequence

91825 reads, 532 reads per million, 128 experiments
uguuguCGGGUGGAUCACGAUGCAAUUUugaugaguaucauaggagaaaAAUUGCACGGUAUCCAUCUGUAaacc
.(((..(((((((((..((.(((((((((..................)))))))))))..)))))))))..))).

Structure
u   gu         CA  A         gaugagua 
 guu  CGGGUGGAU  CG UGCAAUUUu        u
 |||  |||||||||  || |||||||||         
 caa  GUCUACCUA  GC ACGUUAAaa        c
c   AU         UG  -         agaggaua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 134169378-134169452 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-363
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-363 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-363-5p

Accession MIMAT0003385
Description Homo sapiens hsa-miR-363-5p mature miRNA
Sequence 7 - CGGGUGGAUCACGAUGCAAUUU - 28
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-363-3p

Accession MIMAT0000707
Description Homo sapiens hsa-miR-363-3p mature miRNA
Sequence 50 - AAUUGCACGGUAUCCAUCUGUA - 71
Evidence experimental
array-cloned [1], cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267