miRBase entry: mmu-mir-363

Stem-loop mmu-mir-363


Accession
MI0000765
Symbol
MGI: Mir363
Description
Mus musculus mmu-mir-363 precursor miRNA
Gene family
MIPF0000138; mir-363

Literature search
36 open access papers mention mmu-mir-363
(238 sentences)

Sequence

98033 reads, 646 reads per million, 92 experiments
uguuauCAGGUGGAACACGAUGCAAUUUugguugguguaauaggaggaaAAUUGCACGGUAUCCAUCUGUAaacc
.(((..((((((((((.((.(((((((((..(((......)))....))))))))))))).))))))))..))).

Structure
u   au        -  A  A         --gg   gu 
 guu  CAGGUGGA AC CG UGCAAUUUu    uug  g
 |||  |||||||| || || |||||||||    |||   
 caa  GUCUACCU UG GC ACGUUAAaa    gau  u
c   AU        A  -  -         ggag   aa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chrX: 52741693-52741767 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-363
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-363-5p

Accession MIMAT0017076
Description Mus musculus mmu-miR-363-5p mature miRNA
Sequence 7 - CAGGUGGAACACGAUGCAAUUU - 28
Evidence experimental
Illumina [4]
Database links
Predicted targets

Mature mmu-miR-363-3p

Accession MIMAT0000708
Description Mus musculus mmu-miR-363-3p mature miRNA
Sequence 50 - AAUUGCACGGUAUCCAUCUGUA - 71
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267