MIR378A is a small RNA molecule that has been found to be positively correlated with age, along with miR-34a and miR-320b, and negatively associated with age, along with miR-20a, miR-30b, miR-106b, miR-191, miR-301a, and miR-374a [PMC6196565]. The UCCU sequence of RNA has been chosen for analysis due to its presence in small RNAs such as miR23a, MIR378A, and miR344 [PMC6004406]. MIR378A has been found to be downregulated in the sperm of fathers with high paternal depressive symptoms compared to fathers without such symptoms [PMC8157381]. Additionally, MIR378A has been detected in extracellular vesicles (EVs) during the differentiation of human embryonic stem cells into cardiac cells [PMC7912193]. EVs have been shown to contain several other microRNAs (miRNAs) along with MIR378A [PMC7912193]. The levels of primary MIR378A have been determined using quantitative real-time polymerase chain reaction (qRT-PCR) along with 18 s rRNA [PMC8393456]. References: [PMC6196565] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6196565/ [PMC6004406] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6004406/ [PMC8157381] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8157381/ [PMC7912193] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7912193/ [PMC8393456] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8393456/
g C U gu acc agg CU CUGACUCCAGGUCC GUGU u u ||| || |||||||||||||| |||| | ucC GA GACUGAGGUUCAGG CAcg a a G A U au aag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000731 |
Description | Homo sapiens hsa-miR-378a-5p mature miRNA |
Sequence | 5 - CUCCUGACUCCAGGUCCUGUGU - 26 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0000732 |
Description | Homo sapiens hsa-miR-378a-3p mature miRNA |
Sequence | 43 - ACUGGACUUGGAGUCAGAAGGC - 64 |
Evidence |
experimental
cloned [2-3], Northern [2] |
Database links | |
Predicted targets |
|