Accession | MIMAT0000731 |
Description | hsa-miR-378a-5p mature miRNA |
Hairpins | |
Sequence | CUCCUGACUCCAGGUCCUGUGU |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18077375 | has_input UniProtKB:O75896 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18077375 | has_input UniProtKB:Q9UMX1 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19945440 | has_input UniProtKB:P05181 |
involved_in | GO:0032769 negative regulation of monooxygenase activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19945440 | has_input UniProtKB:P05181 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18077375 | has_input UniProtKB:O75896 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18077375 | has_input UniProtKB:Q9UMX1 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19945440 | has_input UniProtKB:P05181 |
involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:1904046 negative regulation of vascular endothelial growth factor production |
ECO:0007001 high throughput mutant phenotypic evidence used in manual assertion |
PMID:18320040 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|