| Accession | MIMAT0000731 |
| Description | hsa-miR-378a-5p mature miRNA |
| Hairpins | |
| Sequence | CUCCUGACUCCAGGUCCUGUGU |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|