WARNING: This summary was generated by AI. Hsa-mir-378, a microRNA, is located on chromosome 5q32 and is variably annotated as MIR-378, MIR 378, miRNA378, hsa-mir-378, and hsa-mir-378a [PMC8071157]. The results from various programs have identified potential targets of hsa-mir-378 and another microRNA, hsa-miR-1827; these findings were consolidated using the Venny v2.1 online tool [PMC5771341].
g C U gu acc agg CU CUGACUCCAGGUCC GUGU u u ||| || |||||||||||||| |||| | ucC GA GACUGAGGUUCAGG CAcg a a G A U au aag
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000731 |
| Description | Homo sapiens hsa-miR-378a-5p mature miRNA |
| Sequence | 5 - CUCCUGACUCCAGGUCCUGUGU - 26 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000732 |
| Description | Homo sapiens hsa-miR-378a-3p mature miRNA |
| Sequence | 43 - ACUGGACUUGGAGUCAGAAGGC - 64 |
| Evidence |
experimental
cloned [2-3], Northern [2] |
| Database links |
|
| Predicted targets |
|
|