Stem-loop mmu-mir-382

Accession

MI0000799

Symbol

MGI: Mir382

Description

Mus musculus mmu-mir-382 precursor miRNA

Gene family

MIPF0000018; mir-154

Literature search

28 open access papers mention mmu-mir-382
(227 sentences)

Sequence

236470 reads, 1104 reads per million, 95 experiments

uacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuugugacgaaUCAUUCACGGACAACACUUUUUucagua
((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))

Structure

    u       -A           UG      - uuu 
uacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||| |||||||  |||||||||||  |||||| |   c
auga cuUUUUU  CAACAGGCACU  CUaagc g   u
    -       CA           UA      a ugu 

Annotation confidence High

Genome context

chr12: 109733771-109733846 [+]

Clustered miRNAs

18 other miRNAs are < 10 kb from mmu-mir-382

Mature mmu-miR-382-5p

• Accession: MIMAT0000747
• Description: Mus musculus mmu-miR-382-5p mature miRNA
• Sequence: 11 - GAAGUUGUUCGUGGUGGAUUCG - 32
• Evidence: experimental ; cloned [1-3], Illumina [4-5]

Mature mmu-miR-382-3p

• Accession: MIMAT0004691
• Description: Mus musculus mmu-miR-382-3p mature miRNA
• Sequence: 49 - UCAUUCACGGACAACACUUUUU - 70
• Evidence: experimental ; cloned [3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267