Stem-loop sequence cel-mir-392

Accession

MI0000819 (change log)

Description

Caenorhabditis elegans miR-392 stem-loop

Gene family

MIPF0000372; mir-392

Stem-loop

   uuuuugaaaauc       cgugu  a    g   u         g      gaaca 
5'             ucgcaga     uc guca cau cgugguuga gauauc     c
               |||||||     || |||| ||| ||||||||| ||||||     a
3'             agcgucu     ag cagu gug gcacuagcu cuauag     a
   -----gacaauc       --uuu  a    a   u         a      aaaaa 

Deep sequencing

308 reads, 0 reads per million, 14 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The 5' end of the mature sequence was mapped by PCR, and the 3' end confirmed later [2].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrX: 13597231-13597340 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000003A6F3_6239
• miRBase Tracker:MI0000819

Mature sequence cel-miR-392-5p

• Accession: MIMAT0020344
• Previous IDs: cel-miR-392*
• Sequence: 31 - agcauucgugguugaggauau - 51
• Deep sequencing: 185 reads, 12 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00004CB3E3_6239

Mature sequence cel-miR-392-3p

• Accession: MIMAT0000768
• Previous IDs: cel-miR-392
• Sequence: 68 - uaucaucgaucacgugugauga - 89
• Deep sequencing: 120 reads, 11 experiments
• Evidence: experimental; cloned [1-2], PCR [1], Illumina [3-4]
• Database links:
  • RNAcentral:URS0000351D9F_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-392
  • microrna.org:cel-miR-392-3p

References

1. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
4. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).