Accession
MI0000822
Symbol
HGNC:
MIR133B
Description
Homo sapiens
hsa-mir-133b precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR133B is a microRNA implicated in various biological processes and has been observed to interact with other RNA molecules and to play a role in disease contexts [PMC7068214]. Specifically, lncRNA LOC400043 has been found to interact with MIR133B, leading to the downregulation of its expression [PMC7068214]. This microRNA has also been utilized in research as a means to attenuate infection by inserting its target sites into the genome of the influenza A virus, demonstrating effective attenuation in murine myocyte-like cells and cardiac tissue [PMC9094651]. Beyond its application in virology, MIR133B has been profiled by researchers studying Parkinson's disease (PD), indicating its potential relevance in the pathology of neurodegenerative diseases [PMC3540391]. The therapeutic potential of MIR133B has been explored through intranasal (IN) delivery, which was assessed for its impact on functional recovery post-spinal cord injury (SCI) using two behavioral tasks: GSM for forelimb grip strength evaluation and a hanging task for forelimb grasp assessment during an 8-week testing time post-SCI [PMC10047048].
Literature search
328 open access papers mention hsa-mir-133b
(1862 sentences)
(1862 sentences)
Sequence
12245
reads,
119
reads per million, 107 experiments
ccucagaagaaagaugcccccugcucuggcuggucaaacggaaccaaguccgucuuccugagaggUUUGGUCCCCUUCAACCAGCUAcagcagggcuggcaaugcccaguccuuggaga
..............(((((((((((.((((((((..((.((.((((((.((.((((...)))))))))))).)).))..)))))))).)))))))..))))....(((.....)))...
..............(((((((((((.((((((((..((.((.((((((.((.((((...)))))))))))).)).))..)))))))).)))))))..))))....(((.....)))...
Structure
----ccucagaagaaaga -- c ca c a u g c
ugcc cccugcu uggcuggu aa gg accaag cc ucuu
|||| ||||||| |||||||| || || |||||| || |||| c
acgg gggacga AUCGACCA UU CC UGGUUU gg agag
agagguuccugacccgua uc c AC C C - - u
Annotation confidence
Not enough data
Do you think this miRNA is real?
Comments
miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1], and later verified in human [2].
Genome context
chr6: 52148923-52149041 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-133b
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-133b is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-133b
| Accession | MIMAT0000770 |
| Description | Homo sapiens hsa-miR-133b mature miRNA |
| Sequence | 66 - UUUGGUCCCCUUCAACCAGCUA - 87 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
References
|
