miRBase entry: rno-mir-24-2

Stem-loop rno-mir-24-2


Accession
MI0000855
Description
Rattus norvegicus rno-mir-24-2 precursor miRNA
Gene family
MIPF0000041; mir-24

Literature search
39 open access papers mention rno-mir-24-2
(185 sentences)

Sequence

391077 reads, 382 reads per million, 494 experiments
gccucucccugggcuccgccuccuGUGCCUACUGAGCUGAAACAGUugauuccagugcacUGGCUCAGUUCAGCAGGAACAGgaguccagcccccauaggagcuggca
(((.((((..(((((....(((((((.(((.(((((((((..((((..((....))..))))..))))))))).))).)))))))...))))).....))))..))).

Structure
-   -u    ---cu     ccgc       G   A         AA    ug  u 
 gcc  cucc     gggcu    cuccuGU CCU CUGAGCUGA  CAGU  au c
 |||  ||||     |||||    ||||||| ||| |||||||||  ||||  ||  
 cgg  gagg     cccga    gagGACA GGA GACUUGACU  GUca  ug c
a   uc    auacc     -ccu       A   C         CG    cg  a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 25318863-25318970 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-mir-24-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-24-3p

Accession MIMAT0000794
Description Rattus norvegicus rno-miR-24-3p mature miRNA
Sequence 61 - UGGCUCAGUUCAGCAGGAACAG - 82
Evidence experimental
cloned [1-4], Northern [2], SOLiD [5]

Mature rno-miR-24-2-5p

Accession MIMAT0005441
Description Rattus norvegicus rno-miR-24-2-5p mature miRNA
Sequence 25 - GUGCCUACUGAGCUGAAACAGU - 46
Evidence experimental
cloned [3], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714