miRBase entry: rno-mir-92a-2

Stem-loop rno-mir-92a-2


Accession
MI0000879
Description
Rattus norvegicus rno-mir-92a-2 precursor miRNA
Gene family
MIPF0000013; mir-25

Literature search
34 open access papers mention rno-mir-92a-2
(178 sentences)

Sequence

348210 reads, 409 reads per million, 499 experiments
ugcccauucauccacAGGUGGGGAUUAGUGCCAUUACuuguguuagauaaaaagUAUUGCACUUGUCCCGGCCUGaggaagaaaagaggguu
.((((.(((.(((.(((((.(((((.(((((.(.(((((............))))).)))))).))))).))))).))).)))....)))).

Structure
u    ---a   a   a     G     U     C U     guguu 
 gccc    uuc ucc cAGGU GGGAU AGUGC A UACuu     a
 ||||    ||| ||| ||||| ||||| ||||| | |||||      
 uggg    aag agg GUCCG CCCUG UCACG U AUgaa     g
u    agaa   a   a     G     U     - U     aaaua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chrX: 140117249-140117340 [-]
Clustered miRNAs
4 other miRNAs are < 10 kb from rno-mir-92a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-92a-3p

Accession MIMAT0000816
Description Rattus norvegicus rno-miR-92a-3p mature miRNA
Sequence 55 - UAUUGCACUUGUCCCGGCCUG - 75
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-miR-92a-2-5p

Accession MIMAT0017108
Description Rattus norvegicus rno-miR-92a-2-5p mature miRNA
Sequence 16 - AGGUGGGGAUUAGUGCCAUUAC - 37
Evidence experimental
SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68