![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-99b |
||||||||||
Accession | MI0000884 (change log) | |||||||||
Description | Rattus norvegicus miR-99b stem-loop | |||||||||
Gene family | MIPF0000033; mir-10 | |||||||||
Literature search |
![]()
13 open access papers mention rno-mir-99b | |||||||||
Stem-loop |
cc ac c c - - c 5' ggcac acccguaga cga cuug g g ggc u ||||| ||||||||| ||| |||| | | ||| 3' cugug ugggugucu gcu gaac c c ccg u cc gu c a a g c |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence rno-miR-99b-5p |
|
Accession | MIMAT0000821 |
Previous IDs | rno-miR-99b |
Sequence |
7 - cacccguagaaccgaccuugcg - 28 |
Deep sequencing | 5735141 reads, 505 experiments |
Evidence | experimental; cloned [1-4], Northern [1,3], SOLiD [5] |
Predicted targets |
|
Mature sequence rno-miR-99b-3p |
|
Accession | MIMAT0004725 |
Previous IDs | rno-miR-99b* |
Sequence |
45 - caagcucgugucuguggguccg - 66 |
Deep sequencing | 19894 reads, 464 experiments |
Evidence | experimental; cloned [4], SOLiD [5] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|