miRBase entry: rno-mir-125a

Stem-loop rno-mir-125a


Accession
MI0000895
Description
Rattus norvegicus rno-mir-125a precursor miRNA
Gene family
MIPF0000033; mir-10

Literature search
44 open access papers mention rno-mir-125a
(224 sentences)

Sequence

5290061 reads, 4841 reads per million, 502 experiments
ugccggccucugggUCCCUGAGACCCUUUAACCUGUGAggacguccagggucACAGGUGAGGUUCUUGGGAGCCuggcgccuggc
.(((((.(.((((((.(((((((.((((..((((((((...(.....)..)))))))))))).))))))).)))))).).)))))

Structure
u     c u      C       C    UA        gga g 
 gccgg c cugggU CCUGAGA CCUU  ACCUGUGA   c u
 ||||| | |||||| ||||||| ||||  ||||||||   | c
 cgguc g gguCCG GGGUUCU GGAG  UGGACAcu   g c
-     c c      A       U    --        -gg a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr1: 59704827-59704911 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from rno-mir-125a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-125a-5p

Accession MIMAT0000829
Description Rattus norvegicus rno-miR-125a-5p mature miRNA
Sequence 15 - UCCCUGAGACCCUUUAACCUGUGA - 38
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-miR-125a-3p

Accession MIMAT0004729
Description Rattus norvegicus rno-miR-125a-3p mature miRNA
Sequence 53 - ACAGGUGAGGUUCUUGGGAGCC - 74
Evidence experimental
cloned [3], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68