Stem-loop sequence rno-mir-125a

Accession

MI0000895 (change log)

Description

Rattus norvegicus miR-125a stem-loop

Gene family

MIPF0000033; mir-10

Literature search

44 open access papers mention rno-mir-125a
(223 sentences)

Stem-loop

   u     c u ug  uc  ug   c    ua        ----  a 
5'  gccgg c c  gg  cc  aga ccuu  accuguga    gg c
    ||||| | |  ||  ||  ||| ||||  ||||||||    ||  
3'  cgguc g g  cc  gg  ucu ggag  uggacacu    cc g
   -     c c gu  ga  gu   u    --        ggga  u 

Deep sequencing

6231686 reads, 4.3e+03 reads per million, 502 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr1: 59704827-59704911 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-125a

• rno-mir-99b: chr1: 59704216-59704285 [+]
• rno-mir-3596c: chr1: 59704372-59704488 [-]
• rno-let-7e: chr1: 59704381-59704473 [+]
• rno-mir-125a: chr1: 59704827-59704911 [+]

Database links

• EntrezGene:Mir125a
• miRBase Tracker:MI0000895

Mature sequence rno-miR-125a-5p

• Accession: MIMAT0000829
• Previous IDs: rno-miR-125a
• Sequence: 15 - ucccugagacccuuuaaccuguga - 38
• Deep sequencing: 6225559 reads, 502 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-125a-5p
  • miRDB:rno-miR-125a-5p
  • microrna.org:rno-miR-125a-5p

Mature sequence rno-miR-125a-3p

• Accession: MIMAT0004729
• Sequence: 53 - acaggugagguucuugggagcc - 74
• Deep sequencing: 6124 reads, 420 experiments
• Evidence: experimental; cloned [3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-125a-3p
  • miRDB:rno-miR-125a-3p
  • microrna.org:rno-miR-125a-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).