Stem-loop sequence ath-MIR169e

AccessionMI0000979 (change log)
DescriptionArabidopsis thaliana miR169e stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

34 open access papers mention ath-MIR169e
(156 sentences)

Stem-loop
   -------ugaugaugaugaugagucacuaauuaauu     a      c   -   g     au  aa  u     u         a          auuuucucaacgaau 
5'                                     guauc uagagu uug cau gaaaa  ag  aa gagau gagccaagg ugacuugccg               c
                                       ||||| |||||| ||| ||| |||||  ||  || ||||| ||||||||| ||||||||||               u
3'                                     cauag aucuca aac gua cuuuu  uc  uu cuuug cucgguuuc guugaacggc               u
   acuacuuacuacuacuauauauacuauacaccaauc     -      -   u   g     cu  cc  c     u         a          cuaugguauuaguca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 20041518-20041734 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR169e
ath-MIR169dchr1: 20039463-20039616 [-]
ath-MIR169echr1: 20041518-20041734 [+]
Database links

Mature sequence ath-miR169e

Accession MIMAT0000909
Sequence

69 - 

ugagccaaggaugacuugccg

 - 89

Get sequence
Evidence experimental; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).