Stem-loop sequence ath-MIR169n

Accession

MI0000988 (change log)

Description

Arabidopsis thaliana miR169n stem-loop

Gene family

MIPF0000012; MIR169_1

Literature search

34 open access papers mention ath-MIR169n
(158 sentences)

Stem-loop

   gaugaagaagagaggucuaacauggcggaaagcgucauguuua           u    u      -u   uuuc    c  c       uuucaaauu    cau    ga         cuu 
5'                                            guagccaagga gacu gccuga  cuu    gccu ca gauucaa         caug   uuug  uuauuauac   u
                                              ||||||||||| |||| ||||||  |||    |||| || |||||||         ||||   ||||  |||||||||    
3'                                            uaucgguuucu cuga cggacu  gga    uggg gu cuaaguu         guac   aaac  gauaauaug   u
   --------------------uaccuaccuuuuucguacaguuc           -    -      uu   ---u    c  u       ---------    uau    ug         aaa 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr3: 9878540-9878754 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR169n

• ath-MIR169n: chr3: 9878540-9878754 [-]
• ath-MIR169m: chr3: 9878168-9878379 [-]
• ath-MIR169l: chr3: 9875893-9876103 [-]
• ath-MIR169k: chr3: 9875525-9875737 [-]
• ath-MIR169j: chr3: 9872333-9872553 [-]
• ath-MIR169i: chr3: 9871960-9872165 [-]

Database links

• RNAcentral:URS000037108A_3702
• miRBase Tracker:MI0000988

Mature sequence ath-miR169n

• Accession: MIMAT0000919
• Sequence: 45 - uagccaaggaugacuugccug - 65
• Evidence: experimental; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).