![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR171c |
|||||
Accession | MI0000990 (change log) | ||||
Description | Arabidopsis thaliana miR171c stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
25 open access papers mention ath-MIR171c | ||||
Stem-loop |
ugagcgcacuaucggacaucaaauacga ug - uac ug 5' gauauugg cgguucaaucaga aaaccg ucuuu u |||||||| ||||||||||||| |||||| ||||| 3' cuauaacc gccgaguuaguuu uuuggc agaaa u -------------------auuugcgca gu a --u uu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1], later experimentally verified [2,3]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR171c-5p |
|
Accession | MIMAT0031900 |
Sequence |
28 - agauauuggugcgguucaauc - 48 |
Evidence | not experimental |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|