Stem-loop sequence ath-MIR172d

AccessionMI0000992 (change log)
DescriptionArabidopsis thaliana miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

54 open access papers mention ath-MIR172d
(290 sentences)

Stem-loop 
          -gu    ua     a    u         ag        uucucu  u      uc 
5' agucauu   uugc  uugca cauc ucaagauuc  aaaucaga      ua ggguuu  u
   |||||||   ||||  ||||| |||| |||||||||  ||||||||      || ||||||   
3' ucgguaa   aacg  gacgu guag aguucuaag  uuugguuu      au uccgag  u
          auu    gc     c    u         ag        ---uuu  u      uu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR172 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for APETALA2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 20587904-20588027 [+]
intergenic
Database links

Mature sequence ath-miR172d-5p

Accession MIMAT0031901
Sequence

18 -  

gcaacaucuucaagauucaga

 - 38

Get sequence
Evidence not experimental

Mature sequence ath-miR172d-3p

Accession MIMAT0000923
Previous IDsath-miR172d
Sequence

88 -  

agaaucuugaugaugcugcag

 - 108

Get sequence
Evidence experimental; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).