![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR390a |
|||||
Accession | MI0001000 (change log) | ||||
Description | Arabidopsis thaliana miR390a stem-loop | ||||
Gene family | MIPF0000101; MIR390 | ||||
Literature search |
![]()
34 open access papers mention ath-MIR390a | ||||
Stem-loop |
-- au u a g --u - c a 5' guag agaaga c gu aagcucagga ggauagcgcca gau gau ac u |||| |||||| | || |||||||||| ||||||||||| ||| ||| || 3' cauc ucuucu g ua uuugaguccu ccuaucgcggu uua cua ug u au cg u c a uuu u u c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
miR390 was independently cloned by the ASRP project [1], and predicted by computational methods [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR390a-5p |
|
Accession | MIMAT0000931 |
Previous IDs | ath-miR390a |
Sequence |
18 - aagcucaggagggauagcgcc - 38 |
Evidence | experimental; cloned [1,3], 454 [4-5], MPSS [4], Illumina [6] |
Mature sequence ath-miR390a-3p |
|
Accession | MIMAT0031902 |
Sequence |
70 - cgcuauccauccugaguuuca - 90 |
Evidence | not experimental |
References |
|
1 |
PMID:15608278
"ASRP: the Arabidopsis Small RNA Project Database"
Nucleic Acids Res. 33:D637-D640(2005).
|
2 |
PMID:15632092
"Computational prediction of miRNAs in Arabidopsis thaliana"
Genome Res. 15:78-91(2005).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|