Stem-loop sequence ath-MIR397b

Accession

MI0001016 (change log)

Description

Arabidopsis thaliana miR397b stem-loop

Gene family

MIPF0000120; MIR397

Literature search

11 open access papers mention ath-MIR397b
(31 sentences)

Stem-loop

   -u   u      c          u          auuu     a   ----u    ca 
5'   gaa gaacau auugagugca cguugaugua    uacuu uuu     auuc  u
     ||| |||||| |||||||||| ||||||||||    ||||| |||     ||||  u
3'   cuu uuugua uaacuuacgu gcgacuauau    augaa aaa     uaag  g
   au   -      u          u          ----     g   uuaau    uu 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR397 family of miRNAs, which are predicted to target mRNAs coding for laccases and beta-6 tubulin [1].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr4: 7878652-7878760 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR397b

• ath-MIR841a: chr4: 7885251-7885462 [-]
• ath-MIR5996: chr4: 7882765-7882889 [-]
• ath-MIR397b: chr4: 7878652-7878760 [-]
• ath-MIR857: chr4: 7878185-7878561 [-]

Database links

• RNAcentral:URS00002BCE02_3702
• miRBase Tracker:MI0001016

Mature sequence ath-miR397b

• Accession: MIMAT0000947
• Sequence: 11 - ucauugagugcaucguugaug - 31
• Evidence: experimental; 5'RACE [1,3], PCR [1], cloned [2], Northern [2], 454 [4-5]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).