![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR397b |
||||||||||
Accession | MI0001016 (change log) | |||||||||
Description | Arabidopsis thaliana miR397b stem-loop | |||||||||
Gene family | MIPF0000120; MIR397 | |||||||||
Literature search |
![]()
11 open access papers mention ath-MIR397b | |||||||||
Stem-loop |
-u u c u auuu a ----u ca 5' gaa gaacau auugagugca cguugaugua uacuu uuu auuc u ||| |||||| |||||||||| |||||||||| ||||| ||| |||| u 3' cuu uuugua uaacuuacgu gcgacuauau augaa aaa uaag g au - u u ---- g uuaau uu |
|||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Comments |
This sequence belongs to the miR397 family of miRNAs, which are predicted to target mRNAs coding for laccases and beta-6 tubulin [1]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence ath-miR397b |
|
Accession | MIMAT0000947 |
Sequence |
11 - ucauugagugcaucguugaug - 31 |
Evidence | experimental; 5'RACE [1,3], PCR [1], cloned [2], Northern [2], 454 [4-5] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|