Stem-loop sequence ath-MIR399c

Accession

MI0001022 (change log)

Description

Arabidopsis thaliana miR399c stem-loop

Gene family

MIPF0000015; MIR399

Literature search

34 open access papers mention ath-MIR399c
(173 sentences)

Stem-loop

           a        u      a        c   u      uuu  aucuuuu 
5' ggagcagu auagggca cuuucu uuggcagg gac uggcua   gu       g
   |||||||| |||||||| |||||| |||||||| ||| ||||||   ||        
3' cuucguca ugucccgu gagagg aaccguuc cug aucggu   ca       u
           c        u      a        a   u      uau  guucuug 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr5: 24962485-24962598 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS00003B7D1A_3702
• miRBase Tracker:MI0001022

Mature sequence ath-miR399c-5p

• Accession: MIMAT0031913
• Sequence: 13 - gggcaucuuucuauuggcagg - 33
• Evidence: not experimental

Mature sequence ath-miR399c-3p

• Accession: MIMAT0000953
• Previous IDs: ath-miR399c
• Sequence: 84 - ugccaaaggagaguugcccug - 104
• Evidence: experimental; PCR [1], cloned [2], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).