![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR399c |
|||||
Accession | MI0001022 (change log) | ||||
Description | Arabidopsis thaliana miR399c stem-loop | ||||
Gene family | MIPF0000015; MIR399 | ||||
Literature search |
![]()
34 open access papers mention ath-MIR399c | ||||
Stem-loop |
a u a c u uuu aucuuuu 5' ggagcagu auagggca cuuucu uuggcagg gac uggcua gu g |||||||| |||||||| |||||| |||||||| ||| |||||| || 3' cuucguca ugucccgu gagagg aaccguuc cug aucggu ca u c u a a u uau guucuug |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR399c-5p |
|
Accession | MIMAT0031913 |
Sequence |
13 - gggcaucuuucuauuggcagg - 33 |
Evidence | not experimental |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|