Stem-loop sequence ath-MIR399e

AccessionMI0001024 (change log)
DescriptionArabidopsis thaliana miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

35 open access papers mention ath-MIR399e
(172 sentences)

Stem-loop 
   -   a     a ag        c   a       u     u      -cccu  u 
5'  gaa gcauu c  ggcgaauc ucu uuggcag ggaag ugauga     ua a
    ||| ||||| |  |||||||| ||| ||||||| ||||| ||||||     || u
3'  cuu cguaa g  ccguuuag agg aaccguc ccuuu acuacu     au g
   a   -     c cu        -   a       u     u      cuuuu  u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 14443504-14443612 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR399e
ath-MIR399dchr2: 14442978-14443077 [-]
ath-MIR399echr2: 14443504-14443612 [+]
ath-MIR399fchr2: 14444997-14445114 [+]
Database links

Mature sequence ath-miR399e

Accession MIMAT0000955
Sequence

79 -  

ugccaaaggagauuugccucg

 - 99

Get sequence
Evidence experimental; PCR [1], MPSS [2], Illumina [3]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).