Stem-loop sequence ath-MIR399f

AccessionMI0001025 (change log)
DescriptionArabidopsis thaliana miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

35 open access papers mention ath-MIR399f
(172 sentences)

Stem-loop 
   auau c     a     a    a  a          u  -     -uu    cu       
5'     g auuac gggca gauc cc uuggcagaga cu auuac   cauu  ugcauc 
       | ||||| ||||| |||| || |||||||||| || |||||   ||||  ||||| a
3'     c uaaug cccgu uuag gg aaccgucucu ga uggug   guaa  acguau 
   uucu u     g     -    a  a          c  g     uuu    au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 14444997-14445114 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR399f
ath-MIR399dchr2: 14442978-14443077 [-]
ath-MIR399echr2: 14443504-14443612 [+]
ath-MIR399fchr2: 14444997-14445114 [+]
Database links

Mature sequence ath-miR399f

Accession MIMAT0000956
Sequence

88 -  

ugccaaaggagauuugcccgg

 - 108

Get sequence
Evidence experimental; PCR [1], cloned [2], Northern [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).