miRBase entry: ath-MIR400

Stem-loop ath-MIR400


Accession
MI0001069
Description
Arabidopsis thaliana ath-MIR400 precursor miRNA
Gene family
MIPF0001157; MIR400

Literature search
7 open access papers mention ath-MIR400
(17 sentences)

Sequence

ugaggauuguuUAUGAGAGUAUUAUAAGUCACuacauuugguaagcaaaguguuguuucucaaacgaagugacuuaugauaaucucaugaauggauuuugca
..((((((.(((((((((.((((((((((((((.(.(((((.((((((....)))))).))))).).)))))))))))))).)))))))))..))))))...

Structure
-ug      -g         G              a a     u      a 
   aggauu  uuUAUGAGA UAUUAUAAGUCACu c uuugg aagcaa g
   ||||||  ||||||||| |||||||||||||| | ||||| ||||||  
   uuuuag  aaguacucu auaguauucaguga g aaacu uuuguu u
acg      gu         a              a c     c      g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 11785936-11786037 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ath-MIR400
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR400

Accession MIMAT0001001
Description Arabidopsis thaliana ath-miR400 mature miRNA
Sequence 12 - UAUGAGAGUAUUAUAAGUCAC - 32
Evidence experimental
cloned [1], Northern [1], 454 [2-3], MPSS [2], Illumina [4]

References

  1. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  2. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  3. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  4. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019