Stem-loop sequence osa-MIR166k

AccessionMI0001107 (change log)
DescriptionOryza sativa miR166k stem-loop
Gene family MIPF0000004; MIR166
Literature search

74 open access papers mention osa-MIR166k
(379 sentences)

Stem-loop 
   auua          u   uu      cu      a      acuccgguuucuccuuuccuac 
5'     gguuaagggg uug  gucugg  cgaggc uccggg                      u
       |||||||||| |||  ||||||  |||||| ||||||                       
3'     ccaauuuccc aac  cggacc  gcuccg aggcuc                      g
   cgua          u   uu      ag      -      gagcggccuuuaauccgcggag
Get sequence
Deep sequencing
31351 reads, 2.12e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 32435003-32435129 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR166k
osa-MIR166hChr2: 32435174-32435292 [-]
osa-MIR166kChr2: 32435003-32435129 [-]
Database links

Mature sequence osa-miR166k-5p

Accession MIMAT0022870
Sequence

13 -  

gguuuguugucuggcucgagg

 - 33

Get sequence
Deep sequencing30 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166k-3p

Accession MIMAT0001037
Previous IDsosa-miR166k
Sequence

97 -  

ucggaccaggcuucaaucccu

 - 117

Get sequence
Deep sequencing31321 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).