![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR171f |
||||||
Accession | MI0001137 (change log) | |||||
Description | Oryza sativa miR171f stem-loop | |||||
Gene family | MIPF0000030; MIR171_1 | |||||
Literature search |
![]()
45 open access papers mention osa-MIR171f | |||||
Stem-loop |
g ag c a c acuagcuaagcaa 5' g gag ug gauguuggcaugguucaauca accgggcaaa uuaugc g | ||| || ||||||||||||||||||||| |||||||||| |||||| a 3' c uuc ac cuauaaccgugccgaguuagu ugguuuguuu gguaug u g ga a c u acguauagggacg |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence osa-miR171f-5p |
|
Accession | MIMAT0022880 |
Sequence |
13 - uguuggcaugguucaaucaaa - 33 |
Deep sequencing | 3 reads, 1 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Mature sequence osa-miR171f-3p |
|
Accession | MIMAT0001067 |
Previous IDs | osa-miR171f |
Sequence |
97 - ugauugagccgugccaauauc - 117 |
Deep sequencing | 545 reads, 2 experiments |
Evidence | by similarity; MI0000214 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|