Stem-loop sequence gga-mir-199-2

Accession

MI0001220 (change log)

Previous IDs

gga-mir-199a-1;gga-mir-199a-2

Description

Gallus gallus miR-199-2 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

8 open access papers mention gga-mir-199-2
(22 sentences)

Stem-loop

   gaagcguccggagauccu    c   gcc       u        c   ---u   ga 
5'                   gcuc guc   ccagugu cagacuac ugu    cag  c
                     |||| |||   ||||||| |||||||| |||    |||  a
3'                   cggg cag   gguuaca gucugaug aca    guc  a
   -------acgaaagggaa    u   auu       c        -   uguu   gu 

Deep sequencing

99380 reads, 1.36e+03 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Chicken has two loci predicted to express miR-199. mir-199-2 (MI0001220) is homologous to mir-199a-2 in human (MI0000281) and mouse (MI0000713). mir-199-1 (MI0001245) is homologous to mir-199b in human (MI0000282) and mouse (MI0000714). The expression of chicken miR-199 has been verified experimentally [2].

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr8: 4652464-4652571 [+]
• Overlapping transcripts:

  antisense

  ENSGALT00000005010 ; DNM3-201; intron 14

Clustered miRNAs

< 10kb from gga-mir-199-2

• gga-mir-199-2: chr8: 4652464-4652571 [+]
• gga-mir-214: chr8: 4658313-4658422 [+]
• gga-mir-214b: chr8: 4658340-4658403 [-]

Database links

• EntrezGene:
• RNAcentral:URS000075E7AE_9031
• miRBase Tracker:MI0001220

Mature sequence gga-miR-199-5p

• Accession: MIMAT0001152
• Previous IDs: gga-miR-199a;gga-miR-199
• Sequence: 29 - cccaguguucagacuaccuguuc - 51
• Deep sequencing: 22116 reads, 5 experiments
• Evidence: experimental; cloned [2], Northern [2]
• Database links:
  • RNAcentral:URS0000554A4F_9031
• Predicted targets:
  • TargetScanVert:gga-miR-199-5p
  • miRDB:gga-miR-199-5p

Mature sequence gga-miR-199-3p

• Accession: MIMAT0003721
• Previous IDs: gga-miR-199*
• Sequence: 67 - uacaguagucugcacauugg - 86
• Deep sequencing: 176606 reads, 5 experiments
• Evidence: experimental; cloned [2], Northern [2]
• Database links:
  • RNAcentral:URS000075AFAC_9031
• Predicted targets:
  • TargetScanVert:gga-miR-199-3p
  • miRDB:gga-miR-199-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.