Stem-loop sequence gga-mir-15b

Accession

MI0001223 (change log)

Description

Gallus gallus miR-15b stem-loop

Gene family

MIPF0000006; mir-15

Literature search

12 open access papers mention gga-mir-15b
(25 sentences)

Stem-loop

   ugagg       gua  cu       c  c           g  gu 
5'      ccuuaaa   cu  agcagca au augguuugcau cu  a
        |||||||   ||  ||||||| || ||||||||||| ||  g
3'      ggaauuu   ga  ucgucgu ua uacuaagcgua ga  u
   ---aa       aaa  uu       u  u           -  ag 

Deep sequencing

7341 reads, 0 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr9: 22277073-22277163 [-]
• Overlapping transcripts:

  sense

  ENSGALT00000032997 ; SMC4-201; intron 4

Clustered miRNAs

< 10kb from gga-mir-15b

• gga-mir-15b: chr9: 22277073-22277163 [-]
• gga-mir-16-2: chr9: 22276898-22276991 [-]

Database links

• EntrezGene:
• miRBase Tracker:MI0001223

Mature sequence gga-miR-15b-5p

• Accession: MIMAT0001154
• Sequence: 19 - uagcagcacaucaugguuugca - 40
• Deep sequencing: 7304 reads, 5 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Predicted targets:
  • TargetScanVert:gga-miR-15b-5p
  • miRDB:gga-miR-15b-5p

Mature sequence gga-miR-15b-3p

• Accession: MIMAT0026524
• Sequence: 58 - gaaucauuauuugcugcuuua - 78
• Deep sequencing: 12 reads, 4 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:gga-miR-15b-3p
  • miRDB:gga-miR-15b-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).