![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-7-2 |
||||||||
Accession | MI0001226 (change log) | |||||||
Description | Gallus gallus miR-7-2 stem-loop | |||||||
Gene family | MIPF0000022; mir-7 | |||||||
Literature search |
![]()
11 open access papers mention gga-mir-7-2 | |||||||
Stem-loop |
-- ac cg cu a a u u au cu 5' gg ggccg gugcccu gg agacu gugauuu guugu gu gg c || ||||| ||||||| || ||||| ||||||| ||||| || || 3' cc ccggc cgcggga cc ucuga cacugaa caaca ca cc a cg -- -a uu g - - c -- cu |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence gga-miR-7 |
|
Accession | MIMAT0001157 |
Sequence |
20 - uggaagacuagugauuuuguug - 41 |
Deep sequencing | 132586 reads, 5 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
References |
|
1 |
PMID:15592404
"Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
Nature. 432:695-716(2004).
|
2 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
3 |
"
Unpublished.
|
4 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|