Stem-loop sequence gga-mir-7-2

AccessionMI0001226 (change log)
DescriptionGallus gallus miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

11 open access papers mention gga-mir-7-2
(155 sentences)

Stem-loop 
   --  ac     cg       cu  a     a       u     u  au  cu 
5'   gg  ggccg  gugcccu  gg agacu gugauuu guugu gu  gg  c
     ||  |||||  |||||||  || ||||| ||||||| ||||| ||  ||   
3'   cc  ccggc  cgcggga  cc ucuga cacugaa caaca ca  cc  a
   cg  --     -a       uu  g     -       -     c  --  cu
Get sequence
Deep sequencing
44488 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 13134720-13134818 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-7-2
gga-mir-3529chr10: 13134724-13134814 [+]
gga-mir-7-2chr10: 13134720-13134818 [-]
gga-mir-1720chr10: 13134585-13134649 [-]
Database links

Mature sequence gga-miR-7

Accession MIMAT0001157
Sequence

20 -  

uggaagacuagugauuuuguug

 - 41

Get sequence
Deep sequencing132586 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).