Stem-loop sequence gga-let-7a-1

AccessionMI0001234 (change log)
DescriptionGallus gallus let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

54 open access papers mention gga-let-7a-1
(270 sentences)

Stem-loop 
   ugca  g     u   gu                uuagg   aua    c 
5'     cu uggga gag  aguagguuguauaguu     guc   cccg a
       || ||||| |||  ||||||||||||||||     |||   ||||  
3'     ga auccu uuc  ucaucuaacauaucaa     uag   gggu a
   ----  a     -   ug                -----   --a    c
Get sequence
Deep sequencing
12827819 reads, 1.53e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 6092517-6092606 [-]
intergenic
Clustered miRNAs
< 10kb from gga-let-7a-1
gga-let-7a-1chr12: 6092517-6092606 [-]
gga-let-7fchr12: 6092103-6092189 [-]
gga-let-7dchr12: 6091058-6091160 [-]
Database links

Mature sequence gga-let-7a-5p

Accession MIMAT0001101
Sequence

13 -  

ugagguaguagguuguauaguu

 - 34

Get sequence
Deep sequencing38180273 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).