![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-7-1 |
|||||
Accession | MI0001272 (change log) | ||||
Description | Gallus gallus miR-7-1 stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
![]()
11 open access papers mention gga-mir-7-1 | ||||
Stem-loop |
--- u - a u a a u -- a 5' ugga gu uggucu gu cugugugg agacu gugauuu guuguu uuuag u |||| || |||||| || |||||||| ||||| ||||||| |||||| ||||| 3' aucu cg acuaga ca gguauacc ucuga cacuaaa caacag aaauu a gac c u - c g - - uu a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gga-miR-7 |
|
Accession | MIMAT0001157 |
Sequence |
23 - uggaagacuagugauuuuguug - 44 |
Deep sequencing | 132586 reads, 5 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
References |
|
1 |
PMID:15592404
"Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
Nature. 432:695-716(2004).
|
2 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
3 |
"
Unpublished.
|
4 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|