Stem-loop sequence ath-MIR413

AccessionMI0001424 (change log)
DescriptionArabidopsis thaliana miR413 stem-loop
Literature search

1 open access papers mention ath-MIR413
(2 sentences)

Stem-loop 
      cc        ucuug       cau    uaa    aggaaccaug     g  --  ag 
5' gau  auaguuuc     uucugca   ccac   cuuc          uccca uu  uc  g
   |||  ||||||||     |||||||   ||||   ||||          ||||| ||  ||   
3' cug  uaucaagg     aagacgu   ggug   gaag          agggu aa  ag  u
      cu        --uca       auc    uua    -guaaacaaa     g  cu  au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 23058034-23058156 [+]
intergenic
Database links

Mature sequence ath-miR413

Accession MIMAT0001321
Sequence

6 -  

auaguuucucuuguucugcac

 - 26

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).