Stem-loop sequence ath-MIR414

AccessionMI0001425 (change log)
DescriptionArabidopsis thaliana miR414 stem-loop
Gene family MIPF0000375; MIR414
Literature search

4 open access papers mention ath-MIR414
(7 sentences)

Stem-loop 
   uca   uua   uc   a        ---a     a  -   a  g    - aucauc 
5'    uca   uca  auc ucauauuc    ucuuc uc auc uc ucau c      a
      |||   |||  ||| ||||||||    ||||| || ||| || |||| |      u
3'    agu   agu  uag aguaugag    agaag ag uag ag agua g      c
   -ag   -ug   -u   -        agug     -  a   a  -    u cuacua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 25137456-25137563 [-]
intergenic
Database links

Mature sequence ath-miR414

Accession MIMAT0001322
Sequence

25 -  

ucaucuucaucaucaucguca

 - 45

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).